control sgrna (Synthego Inc)
86
Structured Review
Synthego Inc
control sgrna
Control Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+sgrna/control+non+ntc+sgrna+targeting/pmc13171165-404-18-23
Average 86 stars, based on 1 article reviews
Control Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+sgrna/control+non+ntc+sgrna+targeting/pmc13171165-404-18-23
Average 86 stars, based on 1 article reviews
control sgrna - by Bioz Stars,
2026-09
86/100 stars
Images
Related Articles
Negative Control:Article Title: B cell receptor signaling is a critical regulator of IgE responses Article Snippet: CRISPR gene targeting was achieved by electroporation of ribonucleoprotein complexes containing Cas9 and single guide RNAs (sgRNAs), adapted from a method published for human B cells.76 Lyophilized modified sgRNAs (Synthego) were designed using Synthego’s sgRNA design tool based on the following criteria in order of importance: 1) cut site within coding region of exon, 2) targeted exon early in coding sequence of protein, 3) cut site early within sequence of exon, 4) high on-target score, 5) target sequence not closely related to off-target sequences. .. Synthego’s Article Title: Human LFA-1 governs T cell immune surveillance of the skin Article Snippet: .. Pools of three single guide RNAs (sgRNAs) targeting either ITGAL (αL) or ITGB2 (β2) and a scrambled Article Title: Flower dependent trafficking of lamellar bodies facilitates maturation of the epidermal barrier. Article Snippet: Briefly, for KO of hFWE, 600 ng of a modified sgRNA (Synthego CRISPRevolution sgRNA EZ Kit) targeting exon 1 of hFWE (5’-GCAUGACGUGGUGGUACCGC-3’) was complexed with 3ug Alt-R Cas9 V3 (IDT 1081058) in vitro. .. Where indicated, a scrambled negative Sequencing:Article Title: B cell receptor signaling is a critical regulator of IgE responses Article Snippet: CRISPR gene targeting was achieved by electroporation of ribonucleoprotein complexes containing Cas9 and single guide RNAs (sgRNAs), adapted from a method published for human B cells.76 Lyophilized modified sgRNAs (Synthego) were designed using Synthego’s sgRNA design tool based on the following criteria in order of importance: 1) cut site within coding region of exon, 2) targeted exon early in coding sequence of protein, 3) cut site early within sequence of exon, 4) high on-target score, 5) target sequence not closely related to off-target sequences. .. Synthego’s Purification:Article Title: Androgen receptor activity in T cells limits checkpoint blockade efficacy. Article Snippet: Immune checkpoint blockade has revolutionized the field of oncology, inducing durable anti-tumour immunity in solid tumours.. In patients with advanced prostate cancer, immunotherapy treatments have largely failed.. Androgen deprivation therapy is classically administered in these patients to inhibit tumour cell growth, and we postulated that this therapy also affects tumour-associated T cells. Control:Article Title: Androgen receptor activity in T cells limits checkpoint blockade efficacy. Article Snippet: Immune checkpoint blockade has revolutionized the field of oncology, inducing durable anti-tumour immunity in solid tumours.. In patients with advanced prostate cancer, immunotherapy treatments have largely failed.. Androgen deprivation therapy is classically administered in these patients to inhibit tumour cell growth, and we postulated that this therapy also affects tumour-associated T cells. Article Title: Human IL-10–producing Th1 cells exhibit a molecular signature distinct from Tr1 cells in malaria Article Snippet: Briefly, 2 μL sgRNA (120 μM) (Synthego) and 2 μL Cas9-NLS (40 μM) (QB3 Macrolab) were mixed and incubated for 15 minutes at 37°C to make a 3:1 ratio Cas9-RNP complex. .. Guides used for each gene were MAF: GAAGUCAUUAACAUAUUCCA; IL10: CAGACAAGGCUUGGCAACCC; PRDM1: multi guides, GUGGUGAAGCUCCCUC, UCCCCGGGAGCAAAACC, GGCAGGGAUGGGCUUGG; and |
